View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14460_high_22 (Length: 257)
Name: NF14460_high_22
Description: NF14460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14460_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 27052853 - 27052614
Alignment:
| Q |
4 |
actacaatcacactttatgattctaannnnnnnatcaagcactttcttatagttattattattgagaaatttcatattaaccagtgtctatgatgccaat |
103 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27052853 |
actacaattacactttatgattctaatttttatatcaagcactttcttatagttattattattgagaaagttcatattaaccagtgtctatgatgccaat |
27052754 |
T |
 |
| Q |
104 |
gatggtgcctcttccagattgagccttagaaagaacagcagttactatatcttgctttacatgcaagaaatcccaacttcttgttgtgtgaagagtaaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27052753 |
gatggtgcctcttccagattgagccttagaaagaacagcagttactatatcttgctttacatgcaagaaatcccaacttcttgttgtgtgaagagtaaga |
27052654 |
T |
 |
| Q |
204 |
attttattcggaatcacacggacaacaccgggaaaatctg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27052653 |
attttattcggaatcacacggacaacaccgggaaaatctg |
27052614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University