View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14460_low_14 (Length: 372)
Name: NF14460_low_14
Description: NF14460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14460_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 12 - 357
Target Start/End: Original strand, 43288020 - 43288369
Alignment:
| Q |
12 |
atagggatagccaaagaaaggttaaatatatatttcctactttgatagaagttcctttccttcacaatggcatatgcttttaaatttattaattgaagtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43288020 |
atagggatagccaaagaaaggttaaatatatatttcctactttgatagaagttcctttccttcacaatggcatatgcttttaaatttattaattgaagtg |
43288119 |
T |
 |
| Q |
112 |
aacccgtttctttcattcagtcatggttcatgtttttactaccaaaatgagaaaaatcaaagttaaagaatcacttatagattagtgatgctgcacttta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43288120 |
aacccgtttctttcattcagtcatggttcatgtttttactaccaaaatgagaaaaatcaaagttaaagaatcacttatagattagtgatgctgcacttta |
43288219 |
T |
 |
| Q |
212 |
atttaataaaattaaagaaaaaag----tatatcacatatatatacgggtaaagttgggtggctttttgttagcatccatttgtcttggtatattatatg |
307 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43288220 |
atttaataaaattaaagaaaaaagtatatatatcacatatatatacgggtaaagttgggtggctttttgttagcatccatttgtcttggtatattatatg |
43288319 |
T |
 |
| Q |
308 |
acgagaaagtgtcaaaaagtttcctttgcagaggatccctatgtacttaa |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43288320 |
acgagaaagtgtcaaaaagtttcctttgcagaggatccctatgtacttaa |
43288369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University