View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14461_low_9 (Length: 231)
Name: NF14461_low_9
Description: NF14461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14461_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 10617756 - 10617549
Alignment:
| Q |
14 |
caaaggaaaaactaccttgacaaatgaaaaattgcattggaagagccataattcgctaagcgaaaatccacttttatgaaatctatatgta-------tc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
10617756 |
caaaagaaaaactaccttgacaaatgaaaaattgtattggaggagccataattcgctaagcgaaagtccacttttatgaaatctatatgtaaagattctc |
10617657 |
T |
|
| Q |
107 |
agccttgtttttagttattcannnnnnnatccaagagagagaaaatttatcgacagagttactttcattatgaggtccattgtatcttggatatcaagca |
206 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10617656 |
tgccttatttttagttattcatttttttatccaagagagagaaaatttaccgagagagttactttcattattaggtccattgtattttggatatcaagca |
10617557 |
T |
|
| Q |
207 |
tttgatgt |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
10617556 |
tttgatgt |
10617549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University