View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14462_high_1 (Length: 271)
Name: NF14462_high_1
Description: NF14462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14462_high_1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 23918589 - 23918851
Alignment:
| Q |
9 |
caagaaaatgatatttctggtagtagcattacagttatacttccaggtggattacatgcttcgccgaacaaaggagagccttctccgttgattcatcgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918589 |
caagaaaatgatatttctggtagtagtattacagttatacttccaggtggattacatgcttcgccgaacaaaggagagccttctccgttgattcatcgat |
23918688 |
T |
 |
| Q |
109 |
ggaaattgggcggaatatgtgactgtggaggttgggatgttggttgcaaacttcttgttctatctaaccagaacctgacttcaaaacctcaccttgagaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918689 |
ggaaattgggcggaatatgtgactgtggaggttgggatgttggttgcaaacttcttgttctatctaaccagaacctgacttcaaaacctcaccttgagaa |
23918788 |
T |
 |
| Q |
209 |
atttcaactttttgttcaggtatacttttgcagtttacttttctgtcaagtcatgtttggata |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918789 |
atttcaactttttgttcaggtatacttttgcagtttacttttctgtcaagtcatgtttggata |
23918851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University