View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14462_low_1 (Length: 271)

Name: NF14462_low_1
Description: NF14462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14462_low_1
NF14462_low_1
[»] chr7 (1 HSPs)
chr7 (9-271)||(23918589-23918851)


Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 9 - 271
Target Start/End: Original strand, 23918589 - 23918851
Alignment:
9 caagaaaatgatatttctggtagtagcattacagttatacttccaggtggattacatgcttcgccgaacaaaggagagccttctccgttgattcatcgat 108  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23918589 caagaaaatgatatttctggtagtagtattacagttatacttccaggtggattacatgcttcgccgaacaaaggagagccttctccgttgattcatcgat 23918688  T
109 ggaaattgggcggaatatgtgactgtggaggttgggatgttggttgcaaacttcttgttctatctaaccagaacctgacttcaaaacctcaccttgagaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23918689 ggaaattgggcggaatatgtgactgtggaggttgggatgttggttgcaaacttcttgttctatctaaccagaacctgacttcaaaacctcaccttgagaa 23918788  T
209 atttcaactttttgttcaggtatacttttgcagtttacttttctgtcaagtcatgtttggata 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23918789 atttcaactttttgttcaggtatacttttgcagtttacttttctgtcaagtcatgtttggata 23918851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University