View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14463_high_10 (Length: 230)
Name: NF14463_high_10
Description: NF14463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14463_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 31661675 - 31661880
Alignment:
| Q |
18 |
gtcccttcatcacataaatttcatctctagatcatcaattcaaaatgagaagttcaaaacctgccaaacttgtatttaaattataataatttttaaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
31661675 |
gtcccttcatcacataaatttcatctctagatcatcaattcaaaatgagaagttcaaaacctgccaaacttgtatttatattataattattttaaaaaca |
31661774 |
T |
|
| Q |
118 |
tatatacnnnnnnnnnatgaaatgttaactaaaaacatgtgaaacccaatgcatttccatttcttgaaaatgnnnnnnnnttggcacaaggttttggttc |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31661775 |
tatatac-ttttttttatgaaatgttaactaaaaacatgtgaaacccaatgcatttccatttcttgaaaatgaaaaaaaattggcacaaggttttggttc |
31661873 |
T |
|
| Q |
218 |
catcccc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
31661874 |
catcccc |
31661880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University