View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14463_high_9 (Length: 250)
Name: NF14463_high_9
Description: NF14463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14463_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 49764852 - 49765085
Alignment:
| Q |
19 |
gggatccaaacacttttattttgatgaattttcttaggctgatgatgatattccaggacccttctc--tccagctatgcacatggaacggaggagactag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49764852 |
gggatccaaacacttttattttgatgaattttcttaggctgatgatgatatcccaggacccttctctctccagctatgcacatggaacggaggagactag |
49764951 |
T |
 |
| Q |
117 |
agagattgcggtaacaattgcaagtactgctgattaggtgcaaacgagagccattggataaatgccacactctatattgctgctagtacatgatctactc |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49764952 |
agagattccggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatctactc |
49765051 |
T |
 |
| Q |
217 |
attgaatgccaatcgaggggaccactaccaccat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49765052 |
attgaatgccaatcgaggggaccactaccaccat |
49765085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University