View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14463_high_9 (Length: 250)

Name: NF14463_high_9
Description: NF14463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14463_high_9
NF14463_high_9
[»] chr4 (1 HSPs)
chr4 (19-250)||(49764852-49765085)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 49764852 - 49765085
Alignment:
19 gggatccaaacacttttattttgatgaattttcttaggctgatgatgatattccaggacccttctc--tccagctatgcacatggaacggaggagactag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
49764852 gggatccaaacacttttattttgatgaattttcttaggctgatgatgatatcccaggacccttctctctccagctatgcacatggaacggaggagactag 49764951  T
117 agagattgcggtaacaattgcaagtactgctgattaggtgcaaacgagagccattggataaatgccacactctatattgctgctagtacatgatctactc 216  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
49764952 agagattccggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatctactc 49765051  T
217 attgaatgccaatcgaggggaccactaccaccat 250  Q
    ||||||||||||||||||||||||||||||||||    
49765052 attgaatgccaatcgaggggaccactaccaccat 49765085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University