View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_high_14 (Length: 400)
Name: NF14464_high_14
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 55 - 381
Target Start/End: Original strand, 43015792 - 43016118
Alignment:
| Q |
55 |
cctctaatttttattggtaatttaaatttcaataaagcatagcatttgattggaacatggatatataggcacgttaatttctaaagaaatgaacgtgatg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015792 |
cctctaatttttattggtaatttaaatttcaataaagcatagcatttgattggaacatggatgtataggcacgttaatttctaaagaaatgaacgtgatg |
43015891 |
T |
 |
| Q |
155 |
tttcactagcagctatacattattaactttataattatatgaaatttcaacgttcggttggtaagtatacgcttttgcacaaaaagatgaaagaacatgc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015892 |
tttcactagcagctatacattattaactttataattatatgaaatttcaacgttcggttggtaagtatacgcttttgcacaaaaagatgaaagaacatgc |
43015991 |
T |
 |
| Q |
255 |
atgaaattaagggttaaggaatgtgtagatcgagtgttgacatgattaataaacattgcttgcatacaccgaaaaattaaatttgtatggacctgaccgg |
354 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43015992 |
atgaaattaagggttaaggaatgtgtatatcgagtgttgacatgattaataaacattgcttgcatacaccgcaaaattaaatttgtatggacctgaccgg |
43016091 |
T |
 |
| Q |
355 |
atgataaatcagtgtcagtagctagct |
381 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43016092 |
atgataaatcagtgtcagtagctagct |
43016118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University