View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_high_18 (Length: 363)
Name: NF14464_high_18
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 48236989 - 48236762
Alignment:
| Q |
1 |
aatacaaaaagcaaatgacannnnnnncgaaatcaaattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaaga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236989 |
aatacaaaaagcaaatgacatttttttcgaaatcaaattttttgatgtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaaga |
48236890 |
T |
|
| Q |
101 |
ggaagagggacgaaaggttgtggaagttaggttatctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236889 |
ggaagagggacgaaaggttgtggaagttaggttatctcaggaggcagctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagca |
48236790 |
T |
|
| Q |
201 |
gcagaggaagccaagaggaaggctgaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48236789 |
gcagaggaagccaagaggaaggctgaac |
48236762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 48236700 - 48236643
Alignment:
| Q |
290 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacacgatgatg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48236700 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatg |
48236643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University