View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_high_23 (Length: 317)
Name: NF14464_high_23
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 44347156 - 44346857
Alignment:
| Q |
1 |
aattatcatgtaataaaaggttatttgtttcgaaactatttaataaaaggatcccaacaaaggataatctaagtcgtcgtggtgtggggcttctgattcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347156 |
aattatcatgtaataaaaggttatttgttttgaaactatttaataaaaggatcccaacaaaggataatctaagtcgtcgtggtgtggggcttctgattcg |
44347057 |
T |
 |
| Q |
101 |
ttacattgttcgggaggacatggtaaggaggaggaaacaattaatcatctatttgttggttgtgacttctttggtagcgttgatggcgcgcttttgttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
44347056 |
ttacattgttcgggaggacatggtaaggaggaggaaacaattaatcatctatttgttggttgtgacttctttggtagtgttgatggtgcgcttttgttcg |
44346957 |
T |
 |
| Q |
201 |
ggaaggaaatcagctcttgtcttcgagtaatctagatgtcctgtatcttggttatttgaaaagaacgtagtgcaagaatttttaatattagagatctttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44346956 |
ggaaggaaatcagctcttgtcttcgagtaatctagatgtcctgtatcttggttatttgaaaagaacgtagtgcaagaatttttaatattagagatctttg |
44346857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 132 - 176
Target Start/End: Complemental strand, 36281727 - 36281683
Alignment:
| Q |
132 |
aggaaacaattaatcatctatttgttggttgtgacttctttggta |
176 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
36281727 |
aggaaacaattaatcatctatttcttggatatgacttctttggta |
36281683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University