View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_low_36 (Length: 257)
Name: NF14464_low_36
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 21 - 158
Target Start/End: Complemental strand, 24929378 - 24929240
Alignment:
| Q |
21 |
tcttaattaaattggaataaaaagtgcattaattcatatatgaaatccttttnnnnnnnnttatatgactaagataatcaagttgtgtattagtttttta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24929378 |
tcttaattaaattggaataaaaagtgcattaattcatatatgaaatccttttaaaaaaaattatatgactaagataatcaagttgtatattagtttttta |
24929279 |
T |
|
| Q |
121 |
atataaggatatttgagtcttttcaa-aaaattgttgca |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24929278 |
atataaggatatttgagtcttttcaaaaaaattgttgca |
24929240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 89 - 149
Target Start/End: Original strand, 33249474 - 33249535
Alignment:
| Q |
89 |
ctaagataatcaagttgtgtattagttt-tttaatataaggatatttgagtcttttcaaaaa |
149 |
Q |
| |
|
|||||| ||| || |||| ||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
33249474 |
ctaagaaaataaaattgtatattagtttgtttaatataagaatattttagtcttttcaaaaa |
33249535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University