View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_low_42 (Length: 242)
Name: NF14464_low_42
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 23 - 207
Target Start/End: Original strand, 41841192 - 41841376
Alignment:
| Q |
23 |
ttaaagagactagtctaatacaaactttaaacttaaaaatacttttattttacaataaattgttcttagcagtattgtagtactatactactannnnnnn |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41841192 |
ttaaagagactagtctaatacaaactttaaacttaaaaatacttttattttacaataaattgttcttagcagtattgtagtactatactactattttttt |
41841291 |
T |
 |
| Q |
123 |
agggatagtactatactactata-nnnnnnnnnagggatgggactatactactatatatttgaatataaaatatgagatatcaaag |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41841292 |
agggatagtactatactactatattttttttttagggatagtactatactactatat-gttgaatataaaatatgagatatcaaag |
41841376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University