View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_low_45 (Length: 237)
Name: NF14464_low_45
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 8369706 - 8369489
Alignment:
| Q |
1 |
taagagactacacatcataatagatgacacactactaaatagaaccgctgaatagttttctgcttaaactattaatggataaacaaatgcaatcaggcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8369706 |
taagagactacacatcataatagatgacacactactaaatagaaccgctgaatagttttctgcttaaactattaatggataaacaaatgcaatcaggcag |
8369607 |
T |
 |
| Q |
101 |
caactttgacaagggaaacaaaccacaagggaatcatcatgatagagagttgtttgcaaatgttaacacatattccaattgtagtcttgcttttgaggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8369606 |
caactttgacaagggaaacaaaccacaagggaatcatcatgatagagagttgtttgcaaatgttaacacatattccaattgtagtcttgcttttgaggtt |
8369507 |
T |
 |
| Q |
201 |
ttcaatgaaaggggaata |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8369506 |
ttcaatgaaaggggaata |
8369489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University