View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14464_low_47 (Length: 206)
Name: NF14464_low_47
Description: NF14464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14464_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 95 - 198
Target Start/End: Complemental strand, 47036954 - 47036851
Alignment:
| Q |
95 |
atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctctgctc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47036954 |
atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctcttctc |
47036855 |
T |
|
| Q |
195 |
ctcc |
198 |
Q |
| |
|
|||| |
|
|
| T |
47036854 |
ctcc |
47036851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University