View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14467_high_4 (Length: 251)

Name: NF14467_high_4
Description: NF14467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14467_high_4
NF14467_high_4
[»] chr8 (2 HSPs)
chr8 (170-237)||(22330967-22331034)
chr8 (63-127)||(22330902-22330966)


Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 170 - 237
Target Start/End: Original strand, 22330967 - 22331034
Alignment:
170 cctcataacgaactccgaattactaatttctcttttcaataaaaatcagaatgtaaaaaataacttct 237  Q
    ||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||    
22330967 cctcagaacgaactccgaattactaatttctctttccaataaaaattagaatgtaaaaaataacttct 22331034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 127
Target Start/End: Original strand, 22330902 - 22330966
Alignment:
63 ttctcaatttcttctactcaagtgattaacgagcttttgtaaagatataattgttcgaatgaacc 127  Q
    ||||||||||| ||||||||| ||||||| ||||||||||||| |||||||||||| ||| ||||    
22330902 ttctcaatttcctctactcaaatgattaaggagcttttgtaaaaatataattgttctaatcaacc 22330966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University