View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14467_low_12 (Length: 205)
Name: NF14467_low_12
Description: NF14467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14467_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 36640852 - 36640666
Alignment:
| Q |
8 |
ggaggagcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgta |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640852 |
ggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgta |
36640755 |
T |
|
| Q |
108 |
tatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttgatgatgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640754 |
tatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 189
Target Start/End: Complemental strand, 36633486 - 36633305
Alignment:
| Q |
8 |
ggaggagcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgta |
107 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36633486 |
ggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgctagtttgcaattcaaaatttattttacagaaatagagaaatctatttgta |
36633387 |
T |
|
| Q |
108 |
tatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttg |
189 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36633386 |
tatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtggggtgtgtttagctgataggtgggattgtgttg |
36633305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University