View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14467_low_5 (Length: 251)
Name: NF14467_low_5
Description: NF14467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14467_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 170 - 237
Target Start/End: Original strand, 22330967 - 22331034
Alignment:
| Q |
170 |
cctcataacgaactccgaattactaatttctcttttcaataaaaatcagaatgtaaaaaataacttct |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
22330967 |
cctcagaacgaactccgaattactaatttctctttccaataaaaattagaatgtaaaaaataacttct |
22331034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 127
Target Start/End: Original strand, 22330902 - 22330966
Alignment:
| Q |
63 |
ttctcaatttcttctactcaagtgattaacgagcttttgtaaagatataattgttcgaatgaacc |
127 |
Q |
| |
|
||||||||||| ||||||||| ||||||| ||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
22330902 |
ttctcaatttcctctactcaaatgattaaggagcttttgtaaaaatataattgttctaatcaacc |
22330966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University