View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14468_high_24 (Length: 320)
Name: NF14468_high_24
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14468_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 200 - 305
Target Start/End: Complemental strand, 12220159 - 12220053
Alignment:
| Q |
200 |
atcatggtaatattaaacttttaaaatagtaaaataagcaaacaacttcttttgtataat-aaataacatatttattttagaaaaacaaaggaaatgaag |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12220159 |
atcatggtaatattaaacttttaaaatagtaaaataaacaaacaacttcttttgtataataaaataacatatttaatttagaaaaacaaaggaaatgaag |
12220060 |
T |
|
| Q |
299 |
atagaag |
305 |
Q |
| |
|
||||||| |
|
|
| T |
12220059 |
atagaag |
12220053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 12220313 - 12220268
Alignment:
| Q |
37 |
gacatatatcattttatttcagtaacattgtagagcgcgttagatc |
82 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
12220313 |
gacatatatcgttttatttcagtaatattgtagagcgcgttggatc |
12220268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University