View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14468_high_33 (Length: 256)
Name: NF14468_high_33
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14468_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 38328518 - 38328745
Alignment:
| Q |
16 |
aaagttatatcgttctccatgatatgtcctgtcatcattctactgtcgagttcccaaaactctagaacactgcggtaaaaatgactagtaccataccttt |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328518 |
aaagttgtatcgttctccatgatatgtcctgtcatcattctactgtcgagttcccaaaactctagaacactgcggtaaaaatgactagtaccataccttt |
38328617 |
T |
 |
| Q |
116 |
ccatattgttcttccaaggatggtgcatgatcttctgctttcaattaatctgtttttcttattacttactgatatttagattgagttgtttctgtaacag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328618 |
ccatattgttcttccaaggatggtgcatgatcttctgctttcaattaatctgtttttcttattacttactgatatttagattgagttgtttctgtaacag |
38328717 |
T |
 |
| Q |
216 |
gttggtggcttgggggatgttgtctgtg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38328718 |
gttggtggcttgggggatgttgtctgtg |
38328745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University