View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14468_high_41 (Length: 210)
Name: NF14468_high_41
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14468_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 47060834 - 47060742
Alignment:
| Q |
12 |
agattattcttaggtgcgaagaaaattggcagaaacnnnnnnngaaactcattttctctgctcaaatttcttgattgagataatatgccaacc |
104 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47060834 |
agattattcttacgtgtgaagaaaattggcagaaacaaaaaaagaaactcattttctctgctcaaatttcttgattgagataatatgccaacc |
47060742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University