View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14468_high_41 (Length: 210)

Name: NF14468_high_41
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14468_high_41
NF14468_high_41
[»] chr7 (1 HSPs)
chr7 (12-104)||(47060742-47060834)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 47060834 - 47060742
Alignment:
12 agattattcttaggtgcgaagaaaattggcagaaacnnnnnnngaaactcattttctctgctcaaatttcttgattgagataatatgccaacc 104  Q
    |||||||||||| ||| |||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
47060834 agattattcttacgtgtgaagaaaattggcagaaacaaaaaaagaaactcattttctctgctcaaatttcttgattgagataatatgccaacc 47060742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University