View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14468_low_27 (Length: 320)

Name: NF14468_low_27
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14468_low_27
NF14468_low_27
[»] chr1 (2 HSPs)
chr1 (200-305)||(12220053-12220159)
chr1 (37-82)||(12220268-12220313)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 200 - 305
Target Start/End: Complemental strand, 12220159 - 12220053
Alignment:
200 atcatggtaatattaaacttttaaaatagtaaaataagcaaacaacttcttttgtataat-aaataacatatttattttagaaaaacaaaggaaatgaag 298  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||    
12220159 atcatggtaatattaaacttttaaaatagtaaaataaacaaacaacttcttttgtataataaaataacatatttaatttagaaaaacaaaggaaatgaag 12220060  T
299 atagaag 305  Q
    |||||||    
12220059 atagaag 12220053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 12220313 - 12220268
Alignment:
37 gacatatatcattttatttcagtaacattgtagagcgcgttagatc 82  Q
    |||||||||| |||||||||||||| ||||||||||||||| ||||    
12220313 gacatatatcgttttatttcagtaatattgtagagcgcgttggatc 12220268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University