View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14468_low_39 (Length: 243)
Name: NF14468_low_39
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14468_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 27693290 - 27693081
Alignment:
| Q |
15 |
aaaatagaatttttccacatatttaaagctaaactagtcttccataaattagtatattctcgttgctactcttgagtttaaacaataaattcataattat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693290 |
aaaatagaatttttccacatatttaaagctaaactagtcttccataaattagtatattctcgttgctactcttgagtttaaacaataaattcataattat |
27693191 |
T |
 |
| Q |
115 |
gaacaacaacattgttaaacctgtgaaaaagccgccttaaaatttaacactgaaccccaaattatggttcttatgtcagtcagatgttgtttaatatgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693190 |
gaacaacaacattgttaaacctgtgaaaaagccgccttaaaatttaacaccgaaccccaaattatggttcttatgtcagtcagatgttgtttaatatgtt |
27693091 |
T |
 |
| Q |
215 |
acgtgtgctt |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
27693090 |
acgtgtgctt |
27693081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University