View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14468_low_42 (Length: 223)

Name: NF14468_low_42
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14468_low_42
NF14468_low_42
[»] chr3 (2 HSPs)
chr3 (122-167)||(14337635-14337680)
chr3 (19-59)||(14337744-14337784)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 122 - 167
Target Start/End: Complemental strand, 14337680 - 14337635
Alignment:
122 caatatgctttctttaaaacataatgagaacttaaatatatggttt 167  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||    
14337680 caatatgctttctttaaaaaataatgagaacttaaatatatggttt 14337635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 14337784 - 14337744
Alignment:
19 cataggaccaaaataaaataaagattatgtagcaatagcat 59  Q
    |||||||||||||||||||||||||||||||||||||||||    
14337784 cataggaccaaaataaaataaagattatgtagcaatagcat 14337744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University