View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14468_low_43 (Length: 211)
Name: NF14468_low_43
Description: NF14468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14468_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 44019678 - 44019498
Alignment:
| Q |
18 |
aggccagaagtagaagcaattaacagcccaaagaagaggaagaagtgcgaatccgaatttgtagaatcttcgtgcgtatttcactgattcttcctctgat |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44019678 |
aggccagaagtagaagcaattaacggcccaaagaagaggaagaagtgcgaatccgaatttgtagaatcttcgtgcgtatttcactgattcttcctctgat |
44019579 |
T |
 |
| Q |
118 |
agtcctagtggaccgtcgatcgttggccataccggaaccgataaagccagcggattggggttcggattagggttgttggtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44019578 |
agtcctagtggaccgtcgatcgttggccataccggaaccgataaagccagcggattggggttcggattagggttgttggtg |
44019498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University