View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14469_high_10 (Length: 241)
Name: NF14469_high_10
Description: NF14469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14469_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 28029976 - 28029756
Alignment:
| Q |
1 |
gcatggttaatgattctaaattgcggttacggttacactgcaaactaaactaaatttagaactttataactgcaattgcagttgcggcccgcaatttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28029976 |
gcatggttaatgattctaaattgcggttacggttacactgcaaactaaa-----tttagaactttataactacaattgcagttgcggcccgcaatttgta |
28029882 |
T |
|
| Q |
101 |
actatgtaattatgatcggnnnnnnnnnnnnnnnnnnactagatatatacttttaaattgaaatgttactgctatggatggaaattcagtaatgtgtcaa |
200 |
Q |
| |
|
|||||||||||||||| || ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28029881 |
actatgtaattatgataggttttgatttttattttttactgg--atatacttttaaattgaaatgttactgctatggatggaaattcagtaatgtgtcaa |
28029784 |
T |
|
| Q |
201 |
tatgtacattgccaattttcaatattat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28029783 |
tatgtacattgccaattttcaatattat |
28029756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University