View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14469_low_10 (Length: 291)
Name: NF14469_low_10
Description: NF14469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14469_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 43602289 - 43602019
Alignment:
| Q |
19 |
ttggcatcaataataattttaaagatgaaagtaattgaatggaacccatgcatcagtgtacgacactaacacatgtcagacattagacacatattcaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43602289 |
ttggcatcaataataattttaaagatgaaagtaattgaatggaacccatgcatcagtgtacgacactaacacatgtcagatattagacacatattcaatg |
43602190 |
T |
 |
| Q |
119 |
tgaaatctccgtacatatgtatgcgcaattctctagctaaaggtaaaggcaatcaa-taacttcagcagaagaagactaatttctctttaattaatcagt |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602189 |
tgaaatctcggtacatatgtatgcgcaattctctagctaaaggtaaaggcaatcaactaacttcagcagaagaagactaatttctctttaattaatcagt |
43602090 |
T |
 |
| Q |
218 |
aagaatcaaagcatccaaagccaatacatgtgtcaccaaatttttctaccctggttaagttaagtggataac |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602089 |
aagaatcaaagcatccaaagccaatacatgt-tcaccaaatttttctaccctggttaagttaagtggataac |
43602019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University