View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14469_low_11 (Length: 262)
Name: NF14469_low_11
Description: NF14469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14469_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 28030108 - 28030356
Alignment:
| Q |
1 |
cctagcagattcaataactcaaatacgaagataccataatacactaaagtaatgttaaaagtatgttacagtttttgttcattgttgtgaagatgaattt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030108 |
cctagcagattccataactcaaatacgaagataccataatacactaaagtaatgttaaaagtatgttacagtttttgttcattgttgtgaagatgaattt |
28030207 |
T |
 |
| Q |
101 |
gtgcatgagaagtttcttttccatgaagcgaagaaatatttagatagatatagatatggataaagttgaagtagaaggttttgcattatattgctcnnnn |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030208 |
gtgcatgagaagtttcttttccatgaagcgaagaaatatttagatagatatagatatggataaagttgaagtagaaggttttgcattatattgctaaaaa |
28030307 |
T |
 |
| Q |
201 |
nnnnnnntatgttttgtattattaacgtagcttatttttagacctttgct |
250 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28030308 |
aaaaatatatgttttgtattattaacgtagctta-ttttagacctttgct |
28030356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University