View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_high_16 (Length: 372)
Name: NF1446_high_16
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_high_16 |
 | |
|
| [»] scaffold0526 (1 HSPs) |
| | |
|
| [»] scaffold0684 (1 HSPs) |
| | |
|
| [»] scaffold0163 (1 HSPs) |
| | |
|
| [»] scaffold1892 (1 HSPs) |
| | |
|
| [»] scaffold1178 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 188458 - 188235
Alignment:
| Q |
16 |
gatttgactaatatttcacaacaatgattgcgtttttatagacaaaagtgctccgagactacaatagttacaagggattgttcnnnnnnncaccacttga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
188458 |
gatttgactaatatttcacaacaatgattgcgtttttatagacaaaagtgctccgagactacaatagttacaagggattgttctttttttcaccacttga |
188359 |
T |
|
| Q |
116 |
tctagatgttgagctgattggtaccagaaatactagtggtactagttctgcttctgcaacaaatgtggatgagtttgatgtgtttgaagatatagaagac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
188358 |
tctagatgttgagctgattggtaccagaaatactagtggtactagttctgcatctgcaacaaatgtggatgagtttgatgtgtctgaagatatagaagac |
188259 |
T |
|
| Q |
216 |
agacaatggaaatggtgcaagtgg |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
188258 |
agacaatggaaatggtgcaagtgg |
188235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 299 - 357
Target Start/End: Complemental strand, 188167 - 188109
Alignment:
| Q |
299 |
catataattgacgatttatttgtgatttatgattacatataacctttgccattaaatat |
357 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188167 |
catataattgacgatttattcgtgatttatgattacatataacctttgccattaaatat |
188109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 357
Target Start/End: Original strand, 55475873 - 55475934
Alignment:
| Q |
296 |
attcatataattgacgatttatttgtgatttatgattacatataacctttgccattaaatat |
357 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
55475873 |
attcatataattgacgatttattcgtgatttatgattgaatataaactttgccattaaatat |
55475934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0526 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0526
Description:
Target: scaffold0526; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 297 - 357
Target Start/End: Original strand, 8041 - 8101
Alignment:
| Q |
297 |
ttcatataattgacgatttatttgtgatttatgattacatataacctttgccattaaatat |
357 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8041 |
ttcatataattggcgatatattcgtgatttatgattacatataagctttgccattaaatat |
8101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 297 - 340
Target Start/End: Complemental strand, 40542023 - 40541980
Alignment:
| Q |
297 |
ttcatataattgacgatttatttgtgatttatgattacatataa |
340 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
40542023 |
ttcatataattggcgatttattcgtgacttatgattacatataa |
40541980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 337
Target Start/End: Complemental strand, 5439 - 5401
Alignment:
| Q |
299 |
catataattgacgatttatttgtgatttatgattacata |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5439 |
catataattgacgatttctttgtgatttatgattgcata |
5401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0163 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0163
Description:
Target: scaffold0163; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 337
Target Start/End: Original strand, 2679 - 2717
Alignment:
| Q |
299 |
catataattgacgatttatttgtgatttatgattacata |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
2679 |
catataattgacgatttctttgtgatttatgattgcata |
2717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1892 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1892
Description:
Target: scaffold1892; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 1218 - 1258
Alignment:
| Q |
299 |
catataattgacgatttatttgtgatttatgattacatata |
339 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
1218 |
catataattggcgatttctttgtgatttatgattgcatata |
1258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1178 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1178
Description:
Target: scaffold1178; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 229 - 269
Alignment:
| Q |
299 |
catataattgacgatttatttgtgatttatgattacatata |
339 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
229 |
catataattggcgatttctttgtgatttatgattgcatata |
269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University