View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_high_22 (Length: 306)
Name: NF1446_high_22
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 42873224 - 42873432
Alignment:
| Q |
17 |
atcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagagatttttaaatcattgttg----ataatatgaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42873224 |
atcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagagatttttaaatcattgttgatatataatatgaaaa |
42873323 |
T |
|
| Q |
113 |
gtaatcatggttatgtatagagttatg-nnnnnnnnnngggtacaatgtatggagttgtgttatttttaaaccaaaatttatacaaacagatatgacacg |
211 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
42873324 |
gtaatcatggttatgtat--agttatgttttttttttttggtacaatgtatggagttgtgttattttcaaaccaaaatttatacaaacagatatgatacg |
42873421 |
T |
|
| Q |
212 |
gtataactcta |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
42873422 |
gtataactcta |
42873432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University