View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_high_31 (Length: 239)
Name: NF1446_high_31
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 49764847 - 49765058
Alignment:
| Q |
14 |
aatatgggatccaaacacttttattttgatgaattttcttaggctgatgatgatattccaggacccttctc--tccagctatgcacatggaacggaggag |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49764847 |
aataagggatccaaacacttttattttgatgaattttcttaggctgatgatgatatcccaggacccttctctctccagctatgcacatggaacggaggag |
49764946 |
T |
 |
| Q |
112 |
actagagagattgcggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatc |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49764947 |
actagagagattccggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatc |
49765046 |
T |
 |
| Q |
212 |
tactcattgaat |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49765047 |
tactcattgaat |
49765058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University