View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_high_35 (Length: 233)
Name: NF1446_high_35
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 214
Target Start/End: Complemental strand, 37145894 - 37145691
Alignment:
| Q |
11 |
tagattatactctttggcctttctactggtaaatttgtacatgatacatcttttcatctttactattttctggagtacccactaaactttctttcttatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145894 |
tagattatactctttggcctttctactggtaaatttgtacatgatacatcttttcatctttactattttctggagtacccactaaactttctttcttatc |
37145795 |
T |
 |
| Q |
111 |
atgtatttgactacaccaattgaatctcaaatttcagtgagtgccgctccaagcacgacacaccttctttgtttccccattccagaggcatcttgagtgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37145794 |
atgtatttgactacaccaattgaatctcaaatttcagtgagtgccgctccaagcacgacacaccttctttgtttccccattccagaggcatcttgagtgc |
37145695 |
T |
 |
| Q |
211 |
actc |
214 |
Q |
| |
|
|||| |
|
|
| T |
37145694 |
actc |
37145691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University