View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_high_40 (Length: 210)
Name: NF1446_high_40
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 3596185 - 3596009
Alignment:
| Q |
18 |
ccctgcaactaatactaatgttgggttcatattaatagtttgtgtgctcaaggtagtttatgtcatattcaaattacgtggttatttgattacttttttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3596185 |
ccctgcaactaatactaatgttgggttcatattaatagtttgtgtcctcaaggtactttatgtcatattcaaattacgtgattatttgattacttttttg |
3596086 |
T |
 |
| Q |
118 |
gagatcatatcagaaaggtgtatattatagcatcatctaattgccaattgcagtgaactatacaagctcataactct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3596085 |
aagatcatatcagaaaggtgtatattatagcatcatctaattgacaattgcagtgaactatacaagctcataactct |
3596009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University