View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_low_10 (Length: 421)
Name: NF1446_low_10
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 4409168 - 4409280
Alignment:
| Q |
1 |
aaatatagcagtgattcagataaatgatcagagagagagtgaaaagatgggccctctaaagcctgaaacagaaatgagtggcactgcaccaaacactata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409168 |
aaatatagcagtgattcagataaatgatcagagagagagtgaaaagatgggccctctaaagcctgaaacagaaatgagtggcactgcaccaaacactata |
4409267 |
T |
 |
| Q |
101 |
cactgtatcaatg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4409268 |
cactgtatcaatg |
4409280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 261 - 418
Target Start/End: Original strand, 4409432 - 4409591
Alignment:
| Q |
261 |
ctacactatagtttgcagtttgcactcttcaatgcttttgttattcttgaggtgannnnnnnn-atatggtataatgtaaagttttttgagcctttt-gt |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| || |
|
|
| T |
4409432 |
ctacactatagtttgcagtttgcactcttcaatgcttttgttattcttgaggtgatttttttttatatggtataatgtaaagttttttgagcttttttgt |
4409531 |
T |
 |
| Q |
359 |
gtgtattggattagagaaatgaatggtatgcactatgcagtaaatcttgatgggatctgt |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4409532 |
gtgtattggattagagaaatgaatggtatgcactatgcaataaatcttgatgggatctgt |
4409591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 4409349 - 4409388
Alignment:
| Q |
182 |
atctttgcatttacatacataggtgcataaactagccccc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409349 |
atctttgcatttacatacataggtgcataaactagccccc |
4409388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University