View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1446_low_25 (Length: 306)

Name: NF1446_low_25
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1446_low_25
NF1446_low_25
[»] chr3 (1 HSPs)
chr3 (17-222)||(42873224-42873432)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 42873224 - 42873432
Alignment:
17 atcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagagatttttaaatcattgttg----ataatatgaaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||    
42873224 atcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagagatttttaaatcattgttgatatataatatgaaaa 42873323  T
113 gtaatcatggttatgtatagagttatg-nnnnnnnnnngggtacaatgtatggagttgtgttatttttaaaccaaaatttatacaaacagatatgacacg 211  Q
    ||||||||||||||||||  |||||||            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||    
42873324 gtaatcatggttatgtat--agttatgttttttttttttggtacaatgtatggagttgtgttattttcaaaccaaaatttatacaaacagatatgatacg 42873421  T
212 gtataactcta 222  Q
    |||||||||||    
42873422 gtataactcta 42873432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University