View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_low_31 (Length: 246)
Name: NF1446_low_31
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 31931695 - 31931928
Alignment:
| Q |
1 |
cattatctttcctctgagttatgtttatcaaagtgagtgtctgcataatagtgcaagtttaagggtgattggcccattgaatctttgannnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| || ||| ||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31931695 |
cattatcttttctctgagttatgtttatccaattgattgtctacataatagtgcaagtttaagggtgactggcccattgaatctttg-cttttttttgtt |
31931793 |
T |
|
| Q |
101 |
nnnccacttttctttattggatttcaacatcacttgaaattatttatttaaggctcaattgaaattgtaacgttgatcttcctattcttatggaattggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31931794 |
tttccacttttctttattggatttcaacatcacttgaaattatttatttaaggctcaattgaaattgtaacgttgatcttcctattcttatggaattggt |
31931893 |
T |
|
| Q |
201 |
caatcctttttaaaatttagtttaattttcttctc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31931894 |
caatcctttttaaaatttagtttaattttcttctc |
31931928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University