View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_low_40 (Length: 230)
Name: NF1446_low_40
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 36495301 - 36495090
Alignment:
| Q |
1 |
ttgggaggaaaacgacgaaatgtaacagatcggcgatgaagtaggggatgctgaagtcaagaacgatgttctgcaaggtattattggcggctgataagcc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36495301 |
ttgggaggaaaatgacgaaatgtaacagatcggcgatgaagtaggggatgctgaagtcaagaacgatgttctgcaaggtattattggcggctgataagcc |
36495202 |
T |
|
| Q |
101 |
acggttggtgtcggctaagccgtgaaagacgcaaatcaagatgctggagtatgtgactcgaacctgaggagttcggtcttggaagagatgaagtaaccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36495201 |
acggttggtgtcggctaagccgtgaaagacgcaaatcaagatgctggagtatgtgactcgaacttgaggagttcggtcttggaagagatgaagtaaccga |
36495102 |
T |
|
| Q |
201 |
taaggtaaaagg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36495101 |
taaggtaaaagg |
36495090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University