View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_low_41 (Length: 226)
Name: NF1446_low_41
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_low_41 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 10759909 - 10760121
Alignment:
| Q |
14 |
aagaaccaaagcgacatgtaaggtgcaaagcaaaaagaaaacaagaagatttataattttagacatatgcgttctcattcttccactcaatccccgaaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10759909 |
aagaaccaaagcgacatgtaaggtgcaaagcaaaaagaaaacaagaagagttataattttagacatatgcgttctcattcttccactcaatccccgaaac |
10760008 |
T |
|
| Q |
114 |
tcactctctttcccgtgagttctttctttgacattcctctttgcagaaagaaagaaaatattttacaaacttcttattcaatcaaaatttaacgtgtgtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760009 |
tcactctctttcccgtgagttctttctttgacattcctctttgcagaaagaaagaaaatattttacaaacttcttattcaatcaaaatttaacgtgtgtg |
10760108 |
T |
|
| Q |
214 |
tgacatgaagcaa |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10760109 |
tgacatgaagcaa |
10760121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University