View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1446_low_42 (Length: 219)
Name: NF1446_low_42
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1446_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 19577736 - 19577934
Alignment:
| Q |
22 |
ggatttggatttggatttgaatgaaagtgattaattcatgatgactttgacacgcggtgagggaggggatatggtgtggagggatgtatcgtaagggaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19577736 |
ggatttggatttggatttgaatgaaagtgattaattcatgatgactttgacacgcggtgagggaggggatatggtgtggagggatgtatcgtaagggaat |
19577835 |
T |
 |
| Q |
122 |
gggtgtgatcttgga------------ttgactattgactgactatggatcctgctcttcaaattttaactctctagattttagttagttgtttttcat |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19577836 |
gggtgtgatcttggattgacatgactgttgactattgactgactatggatcgtgctcttcaaattttaactctctagattttagttagctgtttttcat |
19577934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University