View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1446_low_43 (Length: 218)

Name: NF1446_low_43
Description: NF1446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1446_low_43
NF1446_low_43
[»] chr4 (1 HSPs)
chr4 (18-201)||(49861833-49862016)
[»] chr2 (1 HSPs)
chr2 (30-169)||(13998859-13998998)
[»] chr8 (1 HSPs)
chr8 (79-160)||(8434388-8434469)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 49861833 - 49862016
Alignment:
18 gatcaagcggtcgaatgcgcggtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgta 117  Q
    ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49861833 gatcaagcggtggaatgcgctgtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgta 49861932  T
118 ttgatatgtggtttcagtctcattctacatgtccgctttgtagagcgcccgtggaggctgcgccggttcaagcgaccagacaag 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49861933 ttgatatgtggtttcagtctcattctacatgtccgctttgtagagcgcccgtggaggctgcgccggttcaagcgaccagacaag 49862016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 30 - 169
Target Start/End: Complemental strand, 13998998 - 13998859
Alignment:
30 gaatgcgcggtttgtttatcggagtttgaagatggagaaacaggtcgggttttacccaaatgtaatcatagttttcatattgattgtattgatatgtggt 129  Q
    ||||| || |||||||| ||||| ||||||   || ||||| |||||||||||||||||||| || ||||||||||||| ||| ||||||||||||||||    
13998998 gaatgtgctgtttgtttgtcggaatttgaatccggtgaaacgggtcgggttttacccaaatgcaaacatagttttcatactgagtgtattgatatgtggt 13998899  T
130 ttcagtctcattctacatgtccgctttgtagagcgcccgt 169  Q
    |||| ||||||   || ||||| |||||| | ||||||||    
13998898 ttcattctcatgacacgtgtcctctttgtcgggcgcccgt 13998859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 79 - 160
Target Start/End: Complemental strand, 8434469 - 8434388
Alignment:
79 ttttacccaaatgtaatcatagttttcatattgattgtattgatatgtggtttcagtctcattctacatgtccgctttgtag 160  Q
    ||||||| ||||| |||||| | |||||| | ||||||||||||||||||||||| ||||||||||| ||||| ||||||||    
8434469 ttttaccaaaatgcaatcatgggtttcatttagattgtattgatatgtggtttcaatctcattctacttgtcctctttgtag 8434388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University