View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14471_high_9 (Length: 245)
Name: NF14471_high_9
Description: NF14471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14471_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 26492000 - 26491764
Alignment:
| Q |
1 |
aatgattatgtaaattttactaagcttttagatattgttttgagttgacaccattcatgtatgtattgcagttagagaagcagaagaactagactgggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26492000 |
aatgattatgtaaattttactaagcttttagatattgttttaagttg-caccattcatgtatatattgcagttagagaagcagaagagctagactgggga |
26491902 |
T |
 |
| Q |
101 |
atgagaaagaggatagctatgggaatagcttactgtctagaccacatgcatcaactcacaccacccatttcccacagaaatctgttatcttcttctatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491901 |
atgagaaagaggatagctatgggaatagcttactgtctagaccacatgcataatctcacaccacccatttcccacagaaatctgttatcttcttctatat |
26491802 |
T |
 |
| Q |
201 |
acctcactgaagattatgctgctaaaatatcagacctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26491801 |
acctaactgaagattatgctgctaaaatatcagacctt |
26491764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University