View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14471_low_7 (Length: 258)
Name: NF14471_low_7
Description: NF14471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14471_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 41253595 - 41253367
Alignment:
| Q |
19 |
aggtcactttttattaatttatggagggggaaataaaacggaacaaatgcattcataaatgtggttgtgaatgtgaagtgggaacaccgttattgctaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41253595 |
aggtcactttttattaatttatggagggggaaataaaacggaacaaatgcattcataaatgtggttgtgaatgtgaagtgggaacaccgttattgctaca |
41253496 |
T |
 |
| Q |
119 |
agaccaaaaatggagaatgttctgcatgaaaaatcttactatacatttacccagccagtgacggcactggtataaatattcgacttatgtcctttgcata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41253495 |
agaccaaaaatggagaatgttctgcatgaaaaatcttactatacatttacccagcctgtgacggcactggtataaatattcgac-tatgtcctttgcata |
41253397 |
T |
 |
| Q |
219 |
tgtttgccgtgagacctagacttacctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41253396 |
tgtttgccgtgagacctagacttacctttg |
41253367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University