View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14472_high_10 (Length: 243)
Name: NF14472_high_10
Description: NF14472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14472_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 23 - 221
Target Start/End: Complemental strand, 5310384 - 5310184
Alignment:
| Q |
23 |
agaaagcaagcaaacatttgcagagagtgcatagctataaaagaaatggaaagactcgccttttcgatta--------cttggagaaaattagtgttcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5310384 |
agaaagcaagcaaacatttgcagagagtgcatagctataaaagaaatggaaagactcgccttttcgattacttgtatacttggagaaaattagtgttcta |
5310285 |
T |
 |
| Q |
115 |
ttaaggnnnnnnntataacaacattgtgactgtgagcccctctttattgaaatgatcccctttgtactaggatgacataggatgtcaaaactgccgttgt |
214 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5310284 |
ttaaggaaaaaaatataacaacat------tgtgagcccctctttattgaaatgatcccctttgtactaggatgacataggatgtcaaaactgccgttgt |
5310191 |
T |
 |
| Q |
215 |
tgttctg |
221 |
Q |
| |
|
|| |||| |
|
|
| T |
5310190 |
tgctctg |
5310184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University