View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14472_high_11 (Length: 234)
Name: NF14472_high_11
Description: NF14472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14472_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 5310485 - 5310403
Alignment:
| Q |
134 |
attttgaacttccaatttataggcatcaatgtcaccattgataatcctccgtgacca---ttatagacaaaaccaagttctga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5310485 |
attttgaacttccaatttataggcatcaatgtcaccattgataatcctccgtgaccattattatagacaaaaccaagttctga |
5310403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 5310575 - 5310522
Alignment:
| Q |
5 |
attgcttgtgagtagtggaatttttatagataatgaaaattgtatttgacgaag |
58 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5310575 |
attgcttgtgagtagtggaatttttgtagataatgaaaattgtatttgacgaag |
5310522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University