View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14472_high_12 (Length: 222)
Name: NF14472_high_12
Description: NF14472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14472_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 40 - 205
Target Start/End: Complemental strand, 8878731 - 8878564
Alignment:
| Q |
40 |
gcgtatcatgtgaaggaacaagctatgcatataaaaaagcaggtaaaccatttttggttcaggttcagcat--tcaaagcaagagtggctaaggtttcgt |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8878731 |
gcgtagcatgtgaaggaacaagctatgcatataaaaaagcaggtaaaccatttttggttcaggttcagcatattcaaagcaagagtggctaaggtttcgt |
8878632 |
T |
|
| Q |
138 |
gtaggacataaaccattctcactcccagaaacttacagtattatatggacccaatttaacaccatatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8878631 |
gtaggacataaaccattctcactcccagaaacttacagtattatatggacccaatttaacaccatatt |
8878564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 124 - 205
Target Start/End: Original strand, 8863156 - 8863235
Alignment:
| Q |
124 |
ggctaaggtttcgtgtaggacataaaccattctcactcccagaaacttacagtattatatggacccaatttaacaccatatt |
205 |
Q |
| |
|
||||||||| | |||||||||| ||||||||| | | || |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8863156 |
ggctaaggtgttgtgtaggacacaaaccattccccc--ccggaaatttacagtattatatggacacaatttaacaccatatt |
8863235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 89
Target Start/End: Original strand, 8862930 - 8862973
Alignment:
| Q |
46 |
catgtgaaggaacaagctatgcatataaaaaagcaggtaaacca |
89 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
8862930 |
catgtgaaggaacaagccatgcatatcaaaaagcagataaacca |
8862973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University