View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_29 (Length: 368)
Name: NF14473_high_29
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 12 - 179
Target Start/End: Complemental strand, 44002195 - 44002035
Alignment:
| Q |
12 |
agaatatcaagtgtacagtgtattcaagcataccataaataacgcaatattgcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc |
111 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44002195 |
agaatatcaattgtacagtgtatccaagcataccataa----cgcaat---gcatgattgtgaactatttaaaatttaaaacacaatgagagaaccgacc |
44002103 |
T |
|
| Q |
112 |
gctttaacaaataaaacaagtgaaaataatagcaatttgtcaaattttgtttcatcaaccattgatta |
179 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44002102 |
gctctaacaaataaaacaagtgaaaataatatcaatttgtcaaattttgtttcatcaaccattgatta |
44002035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University