View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_40 (Length: 319)
Name: NF14473_high_40
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_40 |
 | |
|
| [»] scaffold0531 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 21 - 311
Target Start/End: Complemental strand, 7978528 - 7978238
Alignment:
| Q |
21 |
ccacaggtatgagctttgttgccatgtctaagagatgtataccatatttagaaatcaagtttgaaatactacttgaaatatgagcattttgatcttcata |
120 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978528 |
ccacgggtatgaactttgttgccatgtctaagagctgtataccatatttagaaatcaagtttgaaatactacttgaaatatgagcattttgatcttcata |
7978429 |
T |
|
| Q |
121 |
tagtactagacaacatgttaattgaaactttggtatttgaattttcctacagttactctacaatttcctgggcagctagtctagataaaggaaaacaaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978428 |
tagtactagacaacatgttaattgaaactttggtatttgaattttcctacagttactctacaatttcctgggcagctagtctagataaaggaaaacaaga |
7978329 |
T |
|
| Q |
221 |
aaatgtagaatatggatataaggcacatagtacagcaggaacagtctttgacttctttaatgcacttggcactattgcttttgcctatgct |
311 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978328 |
aaatgtacaatatggatataaggcacatagtacagcaggaacagtctttgacttctttaatgcacttggcactattgcttttgcctatgct |
7978238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 39422493 - 39422524
Alignment:
| Q |
19 |
acccacaggtatgagctttgttgccatgtcta |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39422493 |
acccacaggtatgagctttgttgccatgtcta |
39422524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0531 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0531
Description:
Target: scaffold0531; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 310
Target Start/End: Complemental strand, 2652 - 2604
Alignment:
| Q |
262 |
cagtctttgacttctttaatgcacttggcactattgcttttgcctatgc |
310 |
Q |
| |
|
|||||||| | |||||||||||||||||| |||| || ||||||||||| |
|
|
| T |
2652 |
cagtctttaatttctttaatgcacttggctctatcgcgtttgcctatgc |
2604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University