View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_48 (Length: 297)
Name: NF14473_high_48
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 31 - 284
Target Start/End: Complemental strand, 6400956 - 6400696
Alignment:
| Q |
31 |
gaacgtgcgcccttggtaatcaaagaagattatgttgaacttatgaatacatgacatgtagtgcatgtttagttagttagtatttta---tcttgaattg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
6400956 |
gaacgtgcgcccttggtaatcaaagaagattatgttgaacttatgaatacatgacatgtagtgcatgtttagttagttcgtattttatcttcttgaattg |
6400857 |
T |
 |
| Q |
128 |
ttgtctaactaaagaagg-----nnnnnnnnnngtgcatgcatgtgtagttgaaaggtctaggattttttcgtttcatggctcaccttctaatcnnnnnn |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400856 |
ttgtctaactaaagaaggtttttttttttttttgtgcatgcatgtgtagttgaaaggtctaggattttttcgtttcatggctcaccttctaatc-ttgtt |
6400758 |
T |
 |
| Q |
223 |
nnnagcatatgccatatatgtttgatcccagtcacatgtatgcaatactgatatgccttgcc |
284 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400757 |
tttagcatatgccatatatgtatgatcccagtcacatgtatgcaatactgatatgccttgcc |
6400696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University