View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_57 (Length: 280)
Name: NF14473_high_57
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 37395302 - 37395550
Alignment:
| Q |
13 |
gaagaatatgaagatttgcgagaaatcaatgaagaaaatttatctgtgtgaaataatgttgttgatcgtttgttatatagctagaacttgaatttttgat |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37395302 |
gaagaaaatgaagatttgcgagaaatcaatgaagaaaatttatctgtgtaaaataatgttgttgatcgtttgttatatagctagaacttgaattttttat |
37395401 |
T |
 |
| Q |
113 |
tgg-aattttttggataaggaaaatttaggttattggaatatacaattaaattagtaannnnnnnnatagagttaatttagaaattaatttatgtgcacg |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37395402 |
tggaaattttttggataaggaaaatttaggttattggaatatacaattaaattagtaa-tttttttatagagttaatttagaaattaatttatgtgcacg |
37395500 |
T |
 |
| Q |
212 |
gttaatgtcaagattttattcatagtcaattaattatgaatagtcaaatg |
261 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37395501 |
gttaatgtcaagatttttttcatagtcaattaattatgaatagtcaaatg |
37395550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University