View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_58 (Length: 278)
Name: NF14473_high_58
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 6400711 - 6400440
Alignment:
| Q |
1 |
actgatatgccttgcctttgttttgtgcactttat----gcaagtccaattgagtctgttatgtcccttttacttttgacagataacgggcttttgtttc |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400711 |
actgatatgccttgccagtgttttgtgcactttatatatgcaagtccaattgagcctgttatgtcccttttacttttgacagataacgggcttttgtttc |
6400612 |
T |
 |
| Q |
97 |
tttgaatagctcgatatttcattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatgg |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6400611 |
tttgaatagctcgatattacattatattgtatggagcaggttcaaactataatttagttcatttagtgtttgaccatgattgtgagggattaagggatgg |
6400512 |
T |
 |
| Q |
197 |
tgaggtctacgatgttcaaacctttggcaatactgcagatgatccgtttgcatataaaacttatttcctatg |
268 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6400511 |
tgaggtctacggtgttcaaacctttggcaatactgcagatgatccgtgtgcatataaaacttatttcctatg |
6400440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University