View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14473_high_59 (Length: 278)
Name: NF14473_high_59
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14473_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 70 - 262
Target Start/End: Original strand, 42099207 - 42099400
Alignment:
| Q |
70 |
agtaacaccaccctcctccgcgtcactccggcaacaccatctgcaccgctctctctccccctnnnnnnnccagatctacaaaagaatttaacatcgaaga |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42099207 |
agtaacaccaccctcctccgcgtcgctccggcaacaccatctgcaccgctctctctccccctaaaaaaaccagatctacaaaagaatttaacatcgaaga |
42099306 |
T |
 |
| Q |
170 |
agttttgagtgaagtaagttgaatggtgagtgaagattg-aaaaaatcaacaaagttgttaatcttcatcgtttttaatctttccactaccaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099307 |
agttttgagtgaagtaagttgaatggtgagtgaagattgaaaaaaatcaacaaagttgttaatcttcatcgtttttaatctttccactaccaac |
42099400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University