View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14473_high_59 (Length: 278)

Name: NF14473_high_59
Description: NF14473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14473_high_59
NF14473_high_59
[»] chr8 (1 HSPs)
chr8 (70-262)||(42099207-42099400)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 70 - 262
Target Start/End: Original strand, 42099207 - 42099400
Alignment:
70 agtaacaccaccctcctccgcgtcactccggcaacaccatctgcaccgctctctctccccctnnnnnnnccagatctacaaaagaatttaacatcgaaga 169  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||    
42099207 agtaacaccaccctcctccgcgtcgctccggcaacaccatctgcaccgctctctctccccctaaaaaaaccagatctacaaaagaatttaacatcgaaga 42099306  T
170 agttttgagtgaagtaagttgaatggtgagtgaagattg-aaaaaatcaacaaagttgttaatcttcatcgtttttaatctttccactaccaac 262  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42099307 agttttgagtgaagtaagttgaatggtgagtgaagattgaaaaaaatcaacaaagttgttaatcttcatcgtttttaatctttccactaccaac 42099400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University